D18Mit123 Primer Detail MGI Mouse MGI:701605

D18Mit123 Primer Detail

Name

D18Mit123
Primer 1 Sequence

GGAATATATTACAGAAGAAAGCACAGG
Primer 2 Sequence

TCTGACACTGACTGGAACTACACA
ID

MGI:701605
Product Size

117
Other IDs

D18Mit123 (BROAD)
Note

MIT assay: MT2273
Additional information: MIT STS Marker Data Files

DNA segment, Chr 18, Massachusetts Institute of Technology 123

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit123	c	122bp	C3HeB/FeJLe
	D18Mit123	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit123	a	82bp	CAST/EiJ
	b	100bp	SPRET/EiJ
	c	116bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	122bp	C3H/HeJ, DBA/2J
	e	125bp	A/J, AKR/J, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit123	c	124bp	CBA/CaOlaHsd
	D18Mit123	s	122bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24