About   Help   FAQ
D10Mit11 Primer Detail
Primers
  • Name
    D10Mit11
  • Primer 1 Sequence
    GAGAAGTCACTGGGAGCTGG
  • Primer 2 Sequence
    TTGCCAGGTTGCTCTTCTTT
  • ID
    MGI:701597
  • Product Size
    195
  • Other IDs
    D10Mit11 (BROAD)
  • Note
    MIT assay: A88
    Additional information: MIT STS Marker Data Files
Genes
D10Mit11 DNA segment, Chr 10, Massachusetts Institute of Technology 11
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit11 b larger C57BL/6J
f smaller FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit11 a largest C57BL/6, JF1, MSM/Ms
b smaller DBA/2
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit11 m 190bo MOLF/EiJ
s 187bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit11 a 170bp A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
b 173bp SPRET/EiJ
c 199bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit11 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory