D10Mit16 Primer Detail MGI Mouse MGI:701594

D10Mit16 Primer Detail

Name

D10Mit16
Primer 1 Sequence

GGCATCAGCCAACGTACTCT
Primer 2 Sequence

CGAATCCACACCCCTATGAG
ID

MGI:701594
Product Size

150
Other IDs

D10Mit16 (BROAD)
Note

MIT assay: A727
Additional information: MIT STS Marker Data Files

D10Mit16

DNA segment, Chr 10, Massachusetts Institute of Technology 16

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit16	a	134bp	CAST/EiJ
	b	136bp	AKR/J
	c	144bp	NON/ShiLt
	d	146bp	NOD/MrkTac
	e	148bp	A/J, BALB/cJ, LP/J
	f	152bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	g	200bp	SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit16	c	upper	CBA/Kw
	D10Mit16	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24