About   Help   FAQ
D10Mit15 Primer Detail
Primers
  • Name
    D10Mit15
  • Primer 1 Sequence
    ATGCGTACAGGCAAAACACC
  • Primer 2 Sequence
    GCTACATTGGTCTGTGACGC
  • ID
    MGI:701593
  • Product Size
    184
  • Other IDs
    D10Mit15 (BROAD)
  • Note
    MIT assay: D30
    Additional information: MIT STS Marker Data Files
Genes
D10Mit15 DNA Segment, Chr 10, Massachusetts Institute of Technology-15
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit15 b 0.180kb B10.BR-H2k, B10.D2-H2d, BALB.K-H2k, BALB/cJ, C57BL/6
c 0.171kb BALB/cAnNCr, BALB/cByJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit15 a 180bp 129X1/Sv
f 180, 184bp CD-1
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit15 a largest DBA/2
b smaller C57BL/6
c smallest JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit15 a 122bp SPRET/EiJ
b 135bp CAST/EiJ
c 171bp BALB/cJ
d 180bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NON/ShiLt
e 182bp NOD/MrkTac
f 184bp DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit15 l larger LG/J
s smaller SM/J
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory