About   Help   FAQ
D4Mit297 Primer Detail
Primers
  • Name
    D4Mit297
  • Primer 1 Sequence
    AGTGAAGACATGCGCTTCCT
  • Primer 2 Sequence
    GGAGAAGCCAAGCAATCAAA
  • ID
    MGI:701589
  • Product Size
    123
  • Note
    MIT assay: MTH1199
Genes
D4Mit297 DNA Segment, Chr 4, Massachusetts Institute of Technology 297
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit297 a 112bp C3H/HeJ, DBA/2J, LP/J, SPRET/EiJ
b 114bp NOD/MrkTac
c 122bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
d 136bp CAST/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit297 a 0.13kb CBA/Ca
c 0.15kb CAST/EiJ
p 0.125kb STOCK Whrnwi
w 0.125kb STOCK Whrnwi
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit297 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory