D4Mit291 Primer Detail MGI Mouse MGI:701583

D4Mit291 Primer Detail

Name

D4Mit291
Primer 1 Sequence

CCCGCGCCTAAGATTTTAAA
Primer 2 Sequence

CATATGGGAATGATGGGAATG
ID

MGI:701583
Product Size

169
Note

MIT assay: MTH1286

D4Mit291

DNA Segment, Chr 4, Massachusetts Institute of Technology 291

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit291	a	158bp	129X1/Sv
Not Specified	D4Mit291	f	154, 164bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit291	a	154bp	AKR/J
	b	158bp	NON/ShiLt
	c	164bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	d	182bp	NOD/MrkTac
	e	184bp	A/J
	f	186bp	SPRET/EiJ
	g	188bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/19/2026 MGI 6.24