D15Mit246 Primer Detail MGI Mouse MGI:701560

D15Mit246 Primer Detail

Name

D15Mit246
Primer 1 Sequence

GAACTACATCCCCATCCTTAACA
Primer 2 Sequence

ACCAACTCTGGAGATGTCTTCTG
ID

MGI:701560
Product Size

118
Other IDs

D15Mit246 (BROAD)
Note

MIT assay: MTH1595
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 15, Massachusetts Institute of Technology 246

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit246	a	108bp	SPRET/EiJ
	b	116bp	CAST/EiJ
	c	120bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	132bp	A/J, C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit246	a	132bp	A.CA/W, C3H/W, CBA/W
	D15Mit246	b	120bp	129/SvW, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, DBA/2W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit246	c	larger	CBA/Kw
	D15Mit246	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23