About   Help   FAQ
D14Mit257 Primer Detail
Primers
  • Name
    D14Mit257
  • Primer 1 Sequence
    TTGTATAGGCATGTGCTCACG
  • Primer 2 Sequence
    TTTAAAATGATGAGTGTCTTTGCC
  • ID
    MGI:701542
  • Product Size
    93
  • Other IDs
    D14Mit257 (BROAD)
  • Note
    MIT assay: MTH2905
    Additional information: MIT STS Marker Data Files
Genes
D14Mit257 DNA Segment, Chr 14 Massachusetts Institute of Technology 257
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit257 a 96bp B6.Cg-Lepob/+, C57BL/6J
b 100bp CAST/EiJ, NOD/MrkTac
c 104bp AKR/J
d 106bp DBA/2J
e 108bp A/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D14Mit257 b 92bp C57BL/6JOlaHsd, C57BL/10
c 106bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, PWB
d 104bp DBA/2J
j 112bp JF1
l 98bp SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory