D1Mit16 Primer Detail MGI Mouse MGI:701532

D1Mit16 Primer Detail

Name

D1Mit16
Primer 1 Sequence

AGAGTTAGCTGCCTAGCTTGAGTG
Primer 2 Sequence

TGGAAAGATCTAGGGTTGTCAAAA
ID

MGI:701532
Product Size

186
Note

MIT assay: L46

D1Mit16

DNA segment, Chr 1, Massachusetts Institute of Technology 16

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit16	a	186bp	129X1/Sv
Not Specified	D1Mit16	f	181, 186bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit16	a	162bp	NON/ShiLt
	b	181bp	A/J, CAST/EiJ, NOD/MrkTac
	c	186bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
	d	191bp	SPRET/EiJ
	e	197bp	DBA/2J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit16	c	186bp	CBA/CaOlaHsd
	D1Mit16	s	165bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23