D17Mit144 Primer Detail MGI Mouse MGI:701520

D17Mit144 Primer Detail

Name

D17Mit144
Primer 1 Sequence

CAGCCAGAGGTGTGTTAGCA
Primer 2 Sequence

ATAATTCTCCAGCAACAGCACA
ID

MGI:701520
Product Size

144
Other IDs

D17Mit144 (BROAD)
Note

MIT assay: MT2997
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 1000

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit1000	b	152bp	C57BL/6J
Not Specified	D11Mit1000	s	154bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit1000	a	150bp	DBA/2J
	b	154bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J
	c	160bp	NON/ShiLt

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24