About   Help   FAQ
D17Mit147 Primer Detail
Primers
  • Name
    D17Mit147
  • Primer 1 Sequence
    CAATATGACATTTTGTGGAAATCC
  • Primer 2 Sequence
    TACTAGTGTGCACACGCATGC
  • ID
    MGI:701519
  • Product Size
    127
  • Other IDs
    D17Mit147 (BROAD)
  • Note
    MIT assay: MT2726
    Additional information: MIT STS Marker Data Files
Genes
D17Mit147a DNA segment, Chr 17, Massachusetts Institute of Technology 147a
D17Mit147b DNA segment, Chr 17, Massachusetts Institute of Technology 147b
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
D17Mit147a a smaller STOCK t12
b large STOCK tw5, STOCK tw12
c larger C3H
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit147a a 116bp C57BL/6J
b 118bp CAST/EiJ
c 126bp NON/ShiLt
d 128bp B6.Cg-Lepob/+, C3H/HeJ
e 130bp DBA/2J, LP/J, NOD/MrkTac
f 132bp A/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit147a c 120bp CBA/CaOlaHsd
s 122bp SWR/OlaHsd
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory