D14Mit1 Primer Detail MGI Mouse MGI:701514

D14Mit1 Primer Detail

Name

D14Mit1
Primer 1 Sequence

GATCTATATGTCCCAACTATAAAG
Primer 2 Sequence

ATTTTGACTAGGATTGTTTGAGGG
ID

MGI:701514
Product Size

107
Other IDs

D14Mit1 (BROAD)
Note

MIT assay: A103
Additional information: MIT STS Marker Data Files

D14Mit1

DNA segment, Chr 14, Massachusetts Institute of Technology 1

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit1	a	largest	C57BL/6
Not Specified	D14Mit1	b	smaller	DBA/2, JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit1	a	96bp	C3H/HeJ, DBA/2J, LP/J
	b	102bp	CAST/EiJ, NOD/MrkTac
	c	106bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NON/ShiLt
	d	140bp	SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23