About   Help   FAQ
D14Mit4 Primer Detail
Primers
  • Name
    D14Mit4
  • Primer 1 Sequence
    AGGCACCCCCTCACAGTAC
  • Primer 2 Sequence
    TTCATTCCTCCTGCTGACCT
  • ID
    MGI:701510
  • Product Size
    196
  • Other IDs
    D14Mit4 (BROAD)
  • Note
    MIT assay: M228
    Additional information: MIT STS Marker Data Files
Genes
D14Mit4 DNA segment, Chr 14, Massachusetts Institute of Technology 4
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit4 a largest C57BL/6, DBA/2, JF1
b smaller MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit4 a 186bp SPRET/EiJ
b 194bp DBA/2J
c 196bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NON/ShiLt
d 198bp LP/J
e 200bp CAST/EiJ, NOD/MrkTac
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D14Mit4 l larger LG/J
s smaller SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory