About   Help   FAQ
D11Mit141 Primer Detail
Primers
  • Name
    D11Mit141
  • Primer 1 Sequence
    GCCCTTAACCACACCTGATG
  • Primer 2 Sequence
    ATAGAGAACTGGTAGGTTGGTGAG
  • ID
    MGI:701490
  • Product Size
    149
  • Other IDs
    D11Mit141 (BROAD)
  • Note
    MIT assay: MT194
    Additional information: MIT STS Marker Data Files
Genes
D11Mit141 DNA segment, Chr 11, Massachusetts Institute of Technology 141
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit141 a 148bp 129X1/Sv
f 148, 152bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit141 a 148bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
b 152bp NOD/MrkTac
c 158bp NON/ShiLt, SPRET/EiJ
d 226bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory