About   Help   FAQ
D17Mit72 Primer Detail
Primers
  • Name
    D17Mit72
  • Primer 1 Sequence
    GGCTTGGCGACATTCTAATC
  • Primer 2 Sequence
    CAGCAAATTAACTTTCCCATCA
  • ID
    MGI:701410
  • Product Size
    193
  • Other IDs
    D17Mit72 (BROAD)
  • Note
    MIT assay: MPC2074
    Additional information: MIT STS Marker Data Files
Genes
D17Mit72 DNA segment, Chr 17, Massachusetts Institute of Technology 72
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit72 a 190bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv, CD-1
b 202bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit72 a 164bp CAST/EiJ
b 176bp SPRET/EiJ
c 186bp AKR/J
d 188bp NON/ShiLt
e 190bp C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
f 194bp B6.Cg-Lepob/+, C57BL/6J
g 204bp BALB/cJ
h 206bp A/J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D17Mit72 a 184bp AKR/OlaHsd
b 190bp C57BL/6JOlaHsd
c 196bp BALB/cJ
d 188bp 129P3/J, C3H/HeJ, DBA/2J, SJL/J
j 192bp C57BL/10, JF1
p 194bp PWB
w 200bp A/JOlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory