About   Help   FAQ
D17Mit73 Primer Detail
Primers
  • Name
    D17Mit73
  • Primer 1 Sequence
    TGCACATACACATTGTGTCACA
  • Primer 2 Sequence
    AGACCACCTTCTTTGTGAGCA
  • ID
    MGI:701409
  • Product Size
    106
  • Other IDs
    D17Mit73 (BROAD)
  • Note
    MIT assay: MPC161
    Additional information: MIT STS Marker Data Files
Genes
D17Mit73 DNA segment, Chr 17, Massachusetts Institute of Technology 73
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit73 a 98bp 129X1/Sv
f 98, 104bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit73 a 98bp A/J, NOD/MrkTac
b 104bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 108bp CAST/EiJ
d 114bp AKR/J
e 126bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory