About   Help   FAQ
D17Mit78 Primer Detail
Primers
  • Name
    D17Mit78
  • Primer 1 Sequence
    GTGAGTCTGGGCTAGTCTAAAACA
  • Primer 2 Sequence
    AATACGGTGTGTATGAGAGGGG
  • ID
    MGI:701405
  • Product Size
    98
  • Other IDs
    D17Mit78 (BROAD)
  • Note
    MIT assay: MMH170
    Additional information: MIT STS Marker Data Files
Genes
D17Mit78 DNA segment, Chr 17, Massachusetts Institute of Technology 78
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit78 a 88bp NON/ShiLt
b 96bp NOD/MrkTac
c 98bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J
d 100bp C3H/HeJ, CAST/EiJ, SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit78 c 120bp CBA/CaOlaHsd
s 119bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/15/2026
MGI 6.29
The Jackson Laboratory