About   Help   FAQ
D10Mit83 Primer Detail
Primers
  • Name
    D10Mit83
  • Primer 1 Sequence
    GGAAAGACACCCAAAGGTGA
  • Primer 2 Sequence
    CCATAATAACACTCCTCAAATGACT
  • ID
    MGI:701401
  • Product Size
    256
  • Note
    MIT assay: MPC2228
Genes
D10Mit83 DNA segment, Chr 10, Massachusetts Institute of Technology 83
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit83 a 205bp SPRET/EiJ
b 223bp CAST/EiJ
c 243bp DBA/2J
d 251bp B6.Cg-Lepob/+, C57BL/6J
e 273bp AKR/J
f 275bp A/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
g 281bp NOD/MrkTac
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D10Mit83 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit83 c 126bp CBA/CaOlaHsd
s 122bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory