D13Mit193 Primer Detail MGI Mouse MGI:701388

D13Mit193 Primer Detail

Name

D13Mit193
Primer 1 Sequence

ACTGCCCATTCATGTGTGTG
Primer 2 Sequence

AGGAAGAAAAATTAGAAGAGAAAAAAA
ID

MGI:701388
Product Size

122
Other IDs

D13Mit193 (BROAD)
Note

MIT assay: MT2492
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 193

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit193	a	114bp	129X1/Sv
Not Specified	D13Mit193	f	104, 114, 118bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit193	a	100bp	AKR/J
	b	104bp	A/J, NOD/MrkTac
	c	114bp	C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	d	122bp	CAST/EiJ
	e	124bp	BALB/cJ
	f	126bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	130bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23