D1Mit209 Primer Detail MGI Mouse MGI:701356

D1Mit209 Primer Detail

Name

D1Mit209
Primer 1 Sequence

TCCATCCATACTCCTGTCTGC
Primer 2 Sequence

CAAGGACTAGGGCTGTCACTG
ID

MGI:701356
Product Size

98
Other IDs

D1Mit209 (BROAD)
Note

MIT assay: MT261
Additional information: MIT STS Marker Data Files

D1Mit209

DNA segment, Chr 1, Massachusetts Institute of Technology 209

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit209	b	larger	C57BL/6J
	D1Mit209	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit209	a	95bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J
	b	99bp	CAST/EiJ, DBA/2J, NOD/MrkTac
	c	105bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	109bp	NON/ShiLt
	e	133bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24