About   Help   FAQ
D1Mit202 Primer Detail
Primers
  • Name
    D1Mit202
  • Primer 1 Sequence
    CCATAAGCCTCCTCTTTCCC
  • Primer 2 Sequence
    AAAATGAACTCAGCGGGTTG
  • ID
    MGI:701351
  • Product Size
    143
  • Other IDs
    D1Mit202 (BROAD)
  • Note
    MIT assay: MT1081
    Additional information: MIT STS Marker Data Files
Genes
D1Mit202 DNA segment, Chr 1, Massachusetts Institute of Technology 202
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit202 a 125bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac
b 143bp B6.Cg-Lepob/+, C57BL/6J
c 185bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit202 a 155bp A.CA/W
b 143bp 129/SvW, C57BL/6W, C57BL/10W
c 125bp AKR/W, C3H/W, CBA/W
d 100bp BALB/cW, BN/aW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory