About   Help   FAQ
D1Mit200 Primer Detail
Primers
  • Name
    D1Mit200
  • Primer 1 Sequence
    GCCATGTTCATGTACATAGGTAGG
  • Primer 2 Sequence
    ATGGATGGATGGTTTTCCTG
  • ID
    MGI:701349
  • Product Size
    199
  • Other IDs
    D1Mit200 (BROAD)
  • Note
    MIT assay: D1212
    Additional information: MIT STS Marker Data Files
Genes
D1Mit200 DNA segment, Chr 1, Massachusetts Institute of Technology 200
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit200 a 205bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
b 238bp NON/ShiLt
c 242bp LP/J
d 255bp AKR/J
e 275bp DBA/2J
f 297bp A/J, C3H/HeJ
g 301bp CAST/EiJ
h 530bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit200 a 310bp BN/aW
b 297bp A.CA/W
c 275bp C3H/W, CBA/W, DBA/2W
d 255bp AKR/W
e 205bp 129/SvW, BALB/cW, C57BL/6W, C57BL/10W
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D1Mit200 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory