About   Help   FAQ
D8Mit266 Primer Detail
Primers
  • Name
    D8Mit266
  • Primer 1 Sequence
    AGGTGGGCCCTTCTACAATT
  • Primer 2 Sequence
    CTGATCATGGACAAGTGAGTAAGG
  • ID
    MGI:701334
  • Product Size
    104
  • Other IDs
    D8Mit266 (BROAD)
  • Note
    MIT assay: MT4733
    Additional information: MIT STS Marker Data Files
Genes
D8Mit266 DNA segment, Chr 8, Massachusetts Institute of Technology 266
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit266 a 98bp DBA/2J
b 100bp NOD/MrkTac
c 102bp AKR/J, BALB/cJ, LP/J, NON/ShiLt
d 106bp B6.Cg-Lepob/+, C57BL/6J
e 110bp A/J, C3H/HeJ
f 137bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit266 c 94bp CBA/CaOlaHsd
s 97bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory