About   Help   FAQ
D19Mit28 Primer Detail
Primers
  • Name
    D19Mit28
  • Primer 1 Sequence
    TCTTCATGCCCAAAAGAGCT
  • Primer 2 Sequence
    GCATCCTGAATCTCCTGCC
  • ID
    MGI:701321
  • Product Size
    147
  • Other IDs
    D19Mit28 (BROAD)
  • Note
    MIT assay: B728
    Additional information: MIT STS Marker Data Files
Genes
D19Mit28 DNA segment, Chr 19, Massachusetts Institute of Technology 28
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit28 a 148bp 129X1/Sv
f 148, 154bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit28 b smaller C57BL/6J
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit28 m 164bp MOLF/EiJ
s 180bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit28 a 148bp A/J, B6.Cg-Lepob/+, C57BL/6J, LP/J
b 154bp AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NOD/MrkTac
c 164bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D19Mit28 l larger LG/J
s smaller SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory