About   Help   FAQ
DXMit16 Primer Detail
Primers
  • Name
    DXMit16
  • Primer 1 Sequence
    CTGCAATGCCTGCTGTTTTA
  • Primer 2 Sequence
    CCGGAGTACAAAGGGAGTCA
  • ID
    MGI:701306
  • Product Size
    118
  • Note
    MIT assay: B277
Genes
DXMit16 DNA segment, Chr X, Massachusetts Institute of Technology 16
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit16 a 86bp A/J, AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac, NON/ShiLt
b 88bp CAST/EiJ
c 90bp SPRET/EiJ
d 118bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit16 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory