About   Help   FAQ
D13Mit11 Primer Detail
Primers
  • Name
    D13Mit11
  • Primer 1 Sequence
    CATGGCTCCTTTAACCTGTTT
  • Primer 2 Sequence
    CAATGATTAACCCTTGAAAAAACA
  • ID
    MGI:701299
  • Product Size
    147
  • Other IDs
    D13Mit11 (BROAD)
  • Note
    MIT assay: A91
    Additional information: MIT STS Marker Data Files
Genes
D13Mit11 DNA segment, Chr 13, Massachusetts Institute of Technology 11
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D13Mit11 b smaller C57BL/6J
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit11 m 160bp MOLF/EiJ
s 175bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit11 a 145bp B6.Cg-Lepob/+, C57BL/6J
b 155bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
c 159bp NOD/MrkTac
d 160bp CAST/EiJ, LP/J, SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/14/2024
MGI 6.23 		The Jackson Laboratory