About   Help   FAQ
D13Mit16 Primer Detail
Primers
  • Name
    D13Mit16
  • Primer 1 Sequence
    CCAGCTGAAGGCTTACTCGT
  • Primer 2 Sequence
    AAAGTTAGAATCAGCCATTCAAGG
  • ID
    MGI:701298
  • Product Size
    207
  • Other IDs
    D13Mit16 (BROAD)
  • Note
    MIT assay: B374
    Additional information: MIT STS Marker Data Files
Genes
D13Mit16 DNA segment, Chr 13, Massachusetts Institute of Technology 16
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit16 a 178bp 129X1/Sv
f 212bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D13Mit16 c 212bp C3HeB/FeJLe
f smaller FVB/N
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D13Mit16 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory