D13Mit16 Primer Detail MGI Mouse MGI:701298

D13Mit16 Primer Detail

Name

D13Mit16
Primer 1 Sequence

CCAGCTGAAGGCTTACTCGT
Primer 2 Sequence

AAAGTTAGAATCAGCCATTCAAGG
ID

MGI:701298
Product Size

207
Other IDs

D13Mit16 (BROAD)
Note

MIT assay: B374
Additional information: MIT STS Marker Data Files

D13Mit16

DNA segment, Chr 13, Massachusetts Institute of Technology 16

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit16	a	178bp	129X1/Sv
Not Specified	D13Mit16	f	212bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit16	c	212bp	C3HeB/FeJLe
	D13Mit16	f	smaller	FVB/N

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D13Mit16	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/04/2024 MGI 6.13