D13Mit14 Primer Detail MGI Mouse MGI:701295

D13Mit14 Primer Detail

Name

D13Mit14
Primer 1 Sequence

GGAACAGCAAGCTCTAAGGG
Primer 2 Sequence

CTACCAGGCCTCCCAAGATA
ID

MGI:701295
Product Size

144
Note

MIT assay: D29

D13Mit14

DNA segment, Chr 13, Massachusetts Institute of Technology 14

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit14	a	117bp	CAST/EiJ
	b	143bp	NON/ShiLt
	c	144bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	d	148bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	e	153bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D13Mit14	d	147bp	AKR/OlaHsd, BALB/cJ, C57BL/10, DBA/2J
	j	155bP	JF1
	p	143bp	129P3/J, A/JOlaHsd, C3H/HeJ, C57BL/6JOlaHsd, PWB, SJL/J

J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit14	l	0.139kb	SB/LeJ
	D13Mit14	s	0.145kb	M. spretus

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23