About   Help   FAQ
D13Mit14 Primer Detail
Primers
  • Name
    D13Mit14
  • Primer 1 Sequence
    GGAACAGCAAGCTCTAAGGG
  • Primer 2 Sequence
    CTACCAGGCCTCCCAAGATA
  • ID
    MGI:701295
  • Product Size
    144
  • Note
    MIT assay: D29
Genes
D13Mit14 DNA segment, Chr 13, Massachusetts Institute of Technology 14
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit14 a 117bp CAST/EiJ
b 143bp NON/ShiLt
c 144bp A/J, BALB/cJ, C3H/HeJ, LP/J
d 148bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
e 153bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D13Mit14 d 147bp AKR/OlaHsd, BALB/cJ, C57BL/10, DBA/2J
j 155bP JF1
p 143bp 129P3/J, A/JOlaHsd, C3H/HeJ, C57BL/6JOlaHsd, PWB, SJL/J
J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43
Endonuclease Gene Allele Fragments Strains
D13Mit14 l 0.139kb SB/LeJ
s 0.145kb M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory