About   Help   FAQ
D5Mit208 Primer Detail
Primers
  • Name
    D5Mit208
  • Primer 1 Sequence
    TGAACAGTTTGTTCCCTCCC
  • Primer 2 Sequence
    TAATCACATGGCTTCTGGCA
  • ID
    MGI:701278
  • Product Size
    127
  • Other IDs
    D5Mit208 (BROAD)
  • Note
    MIT assay: MT2300
    Additional information: MIT STS Marker Data Files
Genes
D5Mit208 DNA segment, Chr 5, Massachusetts Institute of Technology 208
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit208 a 129bp 129X1/Sv
f 117bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit208 a 96bp SPRET/EiJ
b 117bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
c 120bp A/J
d 129bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
e 131bp LP/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory