D18Mit184 Primer Detail MGI Mouse MGI:701271

D18Mit184 Primer Detail

Name

D18Mit184
Primer 1 Sequence

CACACATGTGTAGGTAGGTAGGTAGG
Primer 2 Sequence

CGCACAAGGACTACTGAAACA
ID

MGI:701271
Product Size

172
Other IDs

D18Mit184 (BROAD)
Note

MIT assay: MT5156
Additional information: MIT STS Marker Data Files

DNA segment, Chr 18, Massachusetts Institute of Technology 184

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit184	a	127bp	C3H/HeJ, DBA/2J, LP/J
	b	147bp	A/J, BALB/cJ
	c	153bp	AKR/J
	d	157bp	NOD/MrkTac
	e	159bp	NON/ShiLt
	f	172bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	219bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D18Mit184	a	172bp	129/SvW, C57BL/6W, C57BL/10W
	b	153bp	AKR/W
	c	147bp	A.CA/W, BALB/cW, BN/aW
	d	127bp	C3H/W, CBA/W, DBA/2W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit184	c	smaller	CBA/Kw
	D18Mit184	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24