About   Help   FAQ
D18Mit184 Primer Detail
Primers
  • Name
    D18Mit184
  • Primer 1 Sequence
    CACACATGTGTAGGTAGGTAGGTAGG
  • Primer 2 Sequence
    CGCACAAGGACTACTGAAACA
  • ID
    MGI:701271
  • Product Size
    172
  • Other IDs
    D18Mit184 (BROAD)
  • Note
    MIT assay: MT5156
    Additional information: MIT STS Marker Data Files
Genes
D18Mit184 DNA segment, Chr 18, Massachusetts Institute of Technology 184
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit184 a 127bp C3H/HeJ, DBA/2J, LP/J
b 147bp A/J, BALB/cJ
c 153bp AKR/J
d 157bp NOD/MrkTac
e 159bp NON/ShiLt
f 172bp B6.Cg-Lepob/+, C57BL/6J
g 219bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D18Mit184 a 172bp 129/SvW, C57BL/6W, C57BL/10W
b 153bp AKR/W
c 147bp A.CA/W, BALB/cW, BN/aW
d 127bp C3H/W, CBA/W, DBA/2W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D18Mit184 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory