DXMit64 Primer Detail MGI Mouse MGI:701270

DXMit64 Primer Detail

Name

DXMit64
Primer 1 Sequence

GGATCAGTTAGCAGGGAAAGG
Primer 2 Sequence

CACAGACTGAGAAGGCTGTCC
ID

MGI:701270
Product Size

130
Other IDs

DXMit64 (BROAD)
Note

MIT assay: D845
Additional information: MIT STS Marker Data Files

DXMit64

DNA segment, Chr X, Massachusetts Institute of Technology 64

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit64	a	114bp	129X1/Sv
Not Specified	DXMit64	f	134bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit64	a	114bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	b	130bp	CAST/EiJ
	c	132bp	SPRET/EiJ
	d	133bp	AKR/J, DBA/2J, NOD/MrkTac
	e	134bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit64	c	207bp	CBA/CaOlaHsd
	DXMit64	s	202bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24