About   Help   FAQ
D10Mit8 Primer Detail
Primers
  • Name
    D10Mit8
  • Primer 1 Sequence
    AGTGTTAGTGGCTGGGGTG
  • Primer 2 Sequence
    TGAACGTTTCAGTTGGTCCA
  • ID
    MGI:701268
  • Product Size
    201
  • Other IDs
    D10Mit8 (BROAD)
  • Note
    MIT assay: M3
    Additional information: MIT STS Marker Data Files
Genes
D10Mit8 DNA segment, Chr 10, Massachusetts Institute of Technology 8
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit8 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:45743 Zobeley E, et al., Genomics. 1998 Jun 1;50(2):260-6
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit8 b 201bp C57BL/6J
c 188bp CASA/RkJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit8 a 188bp CAST/EiJ
b 201bp A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 206bp LP/J
d 208bp B6.Cg-Lepob/+
e 215bp SPRET/EiJ
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:45743 Zobeley E, et al., Fine genetic and comparative mapping of the deafness mutation Ames waltzer on mouse chromosome 10. Genomics. 1998 Jun 1;50(2):260-6
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory