About   Help   FAQ
DXMit67 Primer Detail
Primers
  • Name
    DXMit67
  • Primer 1 Sequence
    TCAATATCATCTGCAATCCCA
  • Primer 2 Sequence
    TTTATTGCCTTTTGATCTATTTTCA
  • ID
    MGI:701267
  • Product Size
    172
  • Other IDs
    DXMit67 (BROAD)
  • Note
    MIT assay: MPC2625
    Additional information: MIT STS Marker Data Files
Genes
DXMit67 DNA segment, Chr X, Massachusetts Institute of Technology 67
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit67 a 160bp SPRET/EiJ
b 174bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
c 184bp A/J, BALB/cJ
d 188bp NON/ShiLt
e 190bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit67 c 157bp CBA/CaOlaHsd
s 144bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory