About   Help   FAQ
D10Mit3 Primer Detail
Primers
  • Name
    D10Mit3
  • Primer 1 Sequence
    GTTGATAGTCCCACCTCACTCA
  • Primer 2 Sequence
    TGAGAAATTCCATCTGTGGC
  • ID
    MGI:701261
  • Product Size
    244
  • Other IDs
    D10Mit3 (BROAD)
  • Note
    MIT assay: A114
    Additional information: MIT STS Marker Data Files
Genes
D10Mit3 DNA segment, Chr 10, Massachusetts Institute of Technology 3
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit3 b largest C57BL/6J
c 215bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit3 a 205bp SPRET/EiJ
b 210bp CAST/EiJ
c 215bp AKR/J, C3H/HeJ, DBA/2J
d 245bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit3 a 260bp 129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
b 225bp AKR/W, BN/aW
c 210bp C3H/W, CBA/W, DBA/2W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit3 c upper CBA/Kw
e lower KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory