D2Mit31 Primer Detail MGI Mouse MGI:701260

D2Mit31 Primer Detail

Name

D2Mit31
Primer 1 Sequence

ATTTGAAAAGACTGGACTCCTCC
Primer 2 Sequence

TGACTGGGAATAACCTCTCTGC
ID

MGI:701260
Product Size

137
Other IDs

D2Mit31 (BROAD)
Note

MIT assay: B311
Additional information: MIT STS Marker Data Files

D2Mit31

DNA segment, Chr 2, Massachusetts Institute of Technology 31

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit31	m	136bp	MOLF/EiJ
Not Specified	D2Mit31	s	96bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit31	a	96bp	CAST/EiJ, SPRET/EiJ
	b	136bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	140bp	A/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/04/2024 MGI 6.13