About   Help   FAQ
D2Mit31 Primer Detail
Primers
  • Name
    D2Mit31
  • Primer 1 Sequence
    ATTTGAAAAGACTGGACTCCTCC
  • Primer 2 Sequence
    TGACTGGGAATAACCTCTCTGC
  • ID
    MGI:701260
  • Product Size
    137
  • Other IDs
    D2Mit31 (BROAD)
  • Note
    MIT assay: B311
    Additional information: MIT STS Marker Data Files
Genes
D2Mit31 DNA segment, Chr 2, Massachusetts Institute of Technology 31
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit31 m 136bp MOLF/EiJ
s 96bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit31 a 96bp CAST/EiJ, SPRET/EiJ
b 136bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 140bp A/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory