D2Mit32 Primer Detail MGI Mouse MGI:701257

D2Mit32 Primer Detail

Name

D2Mit32
Primer 1 Sequence

AGGACAGAGTCACCTTAGTTGTCC
Primer 2 Sequence

ATTTTAAAATTACTTGTGTGGGGC
ID

MGI:701257
Product Size

101
Other IDs

D2Mit32 (BROAD)
Note

MIT assay: B351
Additional information: MIT STS Marker Data Files

D2Mit32

DNA segment, Chr 2, Massachusetts Institute of Technology 32

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit32	a	86bp	SPRET/EiJ
	b	98bp	CAST/EiJ
	c	102bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	d	110bp	A/J, AKR/J, DBA/2J, NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit32	a	110bp	A.CA/W, AKR/W, DBA/2W
	D2Mit32	b	102bp	129/SvW, BALB/cW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23