About   Help   FAQ
D10Mit54 Primer Detail
Primers
  • Name
    D10Mit54
  • Primer 1 Sequence
    TGTGGGACACACACGGAC
  • Primer 2 Sequence
    GGCTAGACAGCGAGGAGATG
  • ID
    MGI:701220
  • Product Size
    104
  • Other IDs
    D10Mit54 (BROAD)
  • Note
    MIT assay: MPC123
    Additional information: MIT STS Marker Data Files
Genes
D10Mit54 DNA segment, Chr 10, Massachusetts Institute of Technology 54
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit54 a 192bp CAST/EiJ
b 202bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 218bp SPRET/EiJ
J:53815 Vacher J, et al., Mamm Genome. 1999 Mar;10(3):239-43
Endonuclease Gene Allele Fragments Strains
D10Mit54 b 0.104kb C57BL/6J, C57BL/10J, C57BR/cdJ, C57L/J
g 0.105kb 129T2/SvEms, GL/Le Ostm1gl/Ostm1gl
m 0.124kb M. m. molossinus
s 0.12kb M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:53815 Vacher J, et al., Genetic localization and transmission of the mouse osteopetrotic grey-lethal mutation. Mamm Genome. 1999 Mar;10(3):239-43
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory