D8Mit143 Primer Detail MGI Mouse MGI:701205

D8Mit143 Primer Detail

Name

D8Mit143
Primer 1 Sequence

AGCCTGAGGTTATGTTTTTTGC
Primer 2 Sequence

GGCCCTCAGGTTTTCTCTCT
ID

MGI:701205
Product Size

279
Other IDs

D8Mit143 (BROAD)
Note

MIT assay: MT1258
Additional information: MIT STS Marker Data Files

D8Mit143

DNA segment, Chr 8, Massachusetts Institute of Technology 143

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit143	a	269bp	AKR/J, C3H/HeJ, DBA/2J
	b	279bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	305bp	CAST/EiJ, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit143	a	279bp	129/SvW, AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W
	D8Mit143	b	269bp	A.CA/W, BN/aW, C3H/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23