About   Help   FAQ
D2Mit175 Primer Detail
Primers
  • Name
    D2Mit175
  • Primer 1 Sequence
    ATGACAAACAAGAAATAGGAAGGC
  • Primer 2 Sequence
    CATGTGCTTGAGCATGCAC
  • ID
    MGI:701181
  • Product Size
    114
  • Note
    MIT assay: MT1036
Genes
D2Mit175 DNA segment, Chr 2, Massachusetts Institute of Technology 175
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit175 a 109bp C57BL/6J
b 113bp LP/J
c 115bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, DBA/2J
d 117bp NON/ShiLt
e 120bp SPRET/EiJ
f 123bp CAST/EiJ
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D2Mit175 C lower CBA/Kw
K upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory