D15Mit74 Primer Detail MGI Mouse MGI:701166

D15Mit74 Primer Detail

Name

D15Mit74
Primer 1 Sequence

TTCTGCCTACACACCAGTGG
Primer 2 Sequence

TGGATTTATGTGTTGTTGCCA
ID

MGI:701166
Product Size

234
Other IDs

D15Mit74 (BROAD)
Note

MIT assay: MPC868
Additional information: MIT STS Marker Data Files

D15Mit74

DNA segment, Chr 15, Massachusetts Institute of Technology 74

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit74	a	largest	MSM/Ms
		b	smaller	C57BL/6, DBA/2
		c	smallest	JF1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit74	a	226bp	AKR/J, BALB/cJ
	b	228bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	250bp	CAST/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24