About   Help   FAQ
D17Mit254 Primer Detail
Primers
  • Name
    D17Mit254
  • Primer 1 Sequence
    GTAACAATGAAACGAAACAAAAACA
  • Primer 2 Sequence
    TTAGCAAGGGCTTAAGAGAACC
  • ID
    MGI:701158
  • Product Size
    124
  • Other IDs
    D17Mit254 (BROAD)
  • Note
    MIT assay: MTH1696
    Additional information: MIT STS Marker Data Files
Genes
D17Mit254 DNA segment, Chr 17, Massachusetts Institute of Technology 254
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit254 a 124bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
b 128bp NON/ShiLt
c 138bp SPRET/EiJ
d 146bp CAST/EiJ
J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6
Endonuclease Gene Allele Fragments Strains
D17Mit254 b smaller C57BL/6J
l larger C57L/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/21/2024
MGI 6.23 		The Jackson Laboratory