D11Mit78 Primer Detail MGI Mouse MGI:701153

D11Mit78 Primer Detail

Name

D11Mit78
Primer 1 Sequence

GTGGGAGAAACCTTTACGCA
Primer 2 Sequence

TCCTAGTGACCACACTAATTTGTG
ID

MGI:701153
Product Size

103
Other IDs

D11Mit78 (BROAD)
Note

MIT assay: MPC557
Additional information: MIT STS Marker Data Files

D11Mit78

DNA segment, Chr 11, Massachusetts Institute of Technology 78

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit78	a	80bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	104bp	SPRET/EiJ
	c	106bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	110bp	CAST/EiJ
	e	122bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit78	a	122bp	AKR/W
	b	106bp	C57BL/6W, C57BL/10W
	c	80bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit78	c	lower	CBA/Kw
	D11Mit78	k	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24