About   Help   FAQ
D17Mit105 Primer Detail
Primers
  • Name
    D17Mit105
  • Primer 1 Sequence
    CCCTATAGCCTTTATCTGGGG
  • Primer 2 Sequence
    TGTACAACCTCTTGGGGCTC
  • ID
    MGI:701146
  • Product Size
    115
  • Other IDs
    D17Mit105 (BROAD)
  • Note
    MIT assay: MT620
    Additional information: MIT STS Marker Data Files
Genes
D17Mit105 DNA segment, Chr 17, Massachusetts Institute of Technology 105
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit105 a smallest STOCK tw12
b larger STOCK tw5
c largest C3H
d large STOCK t12
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit105 a small C3.SW-H2b, C57BL/6, C57BL/10
b medium C3H/HeJ
c large B10.CAS3
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit105 a smallest CAST/EiJ, RIIIS/J
b larger C57BL/6J, DBA/2J, SJL/J, SM/J, SWR/J
c larger than above CBA/J, P/J
d larger than above M. spretus
e larger than above A.CA-H2f/Sn
f larger than above M. caroli
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit105 a 103bp CAST/EiJ
b 117bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, NON/ShiLt
c 119bp A/J, LP/J
d 121bp AKR/J, C3H/HeJ
e 129bp NOD/MrkTac
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory