About   Help   FAQ
D17Mit104 Primer Detail
Primers
  • Name
    D17Mit104
  • Primer 1 Sequence
    GGACATGATCACCACCTACTCA
  • Primer 2 Sequence
    ATGAATGGAAATCTGCAATGG
  • ID
    MGI:701145
  • Product Size
    110
  • Other IDs
    D17Mit104 (BROAD)
  • Note
    MIT assay: MT859
    Additional information: MIT STS Marker Data Files
Genes
D17Mit104 DNA segment, Chr 17, Massachusetts Institute of Technology 104
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit104 a larger STOCK t12, STOCK tw5
b smallest STOCK tw12
c large C3H
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit104 a small C3.SW-H2b
b medium C3H/HeJ
c large C57BL/6, C57BL/10
d larger B10.CAS4
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit104 a 100bp LP/J
b 106bp AKR/J, C3H/HeJ
c 108bp CAST/EiJ
d 112bp B6.Cg-Lepob/+, C57BL/6J
e 114bp A/J, NOD/MrkTac, NON/ShiLt
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory