About   Help   FAQ
D17Mit106 Primer Detail
Primers
  • Name
    D17Mit106
  • Primer 1 Sequence
    CAGGCAAGACTGGGGATTTT
  • Primer 2 Sequence
    GCTAGCAGTGAGCATCAGTCA
  • ID
    MGI:701143
  • Product Size
    149
  • Other IDs
    D17Mit106 (BROAD)
  • Note
    MIT assay: MMH363
    Additional information: MIT STS Marker Data Files
Genes
D17Mit106 DNA segment, Chr 17, Massachusetts Institute of Technology 106
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit106 b larger than f C57BL/6J
c 147bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit106 a 133bp CAST/EiJ, LP/J
b 147bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
c 149bp SPRET/EiJ
d 151bp NOD/MrkTac
e 153bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory