About   Help   FAQ
D9Mit286 Primer Detail
Primers
  • Name
    D9Mit286
  • Primer 1 Sequence
    CAAAATGTCATATTCTTGTGTTTGG
  • Primer 2 Sequence
    GTCTTCTTTTACAAATTTCCCAGC
  • ID
    MGI:701106
  • Product Size
    108
  • Other IDs
    D9Mit286 (BROAD)
  • Note
    MIT assay: MTH666
    Additional information: MIT STS Marker Data Files
Genes
D9Mit286 DNA segment, Chr 9, Massachusetts Institute of Technology 286
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit286 a 92bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
b 100bp AKR/J, DBA/2J
c 106bp LP/J
d 108bp B6.Cg-Lepob/+, C57BL/6J
e 112bp NON/ShiLt
f 124bp CAST/EiJ
g 170bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit286 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory