About   Help   FAQ
D8Mit318 Primer Detail
Primers
  • Name
    D8Mit318
  • Primer 1 Sequence
    TTACAGATTTGGGGATTCATATTC
  • Primer 2 Sequence
    CAGACTCCCAGGTAAAGGCA
  • ID
    MGI:701098
  • Product Size
    124
  • Other IDs
    D8Mit318 (BROAD)
  • Note
    MIT assay: MTH1143
    Additional information: MIT STS Marker Data Files
Genes
D8Mit318 DNA Segment, Chr 8, Massachusetts Institute of Technology 318
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit318 a 124bp 129X1/Sv
f 118, 124bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit318 a 118bp A/J, AKR/J, C3H/HeJ, DBA/2J, NON/ShiLt
b 124bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
c 132bp BALB/cJ
d 140bp SPRET/EiJ
e 146bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D8Mit318 a 132bp BALB/cW
b 124bp 129/SvW, BN/aW, C57BL/6W, C57BL/10W
c 118bp A.CA/W, AKR/W, C3H/W, CBA/W, DBA/2W
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D8Mit318 c lower CBA/Kw
e upper KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory