About   Help   FAQ
D16Mit9 Primer Detail
Primers
  • Name
    D16Mit9
  • Primer 1 Sequence
    TCTTGCTCTGGTATCAACTACAGG
  • Primer 2 Sequence
    CCTCCTTGCCCAGCTAAAC
  • ID
    MGI:701077
  • Product Size
    143
  • Other IDs
    D16Mit9 (BROAD)
  • Note
    MIT assay: B159
    Additional information: MIT STS Marker Data Files
Genes
D16Mit9 DNA segment, Chr 16, Massachusetts Institute of Technology 9
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit9 m 166bp MOLF/EiJ
s 140bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit9 a 126bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
b 130bp SPRET/EiJ
c 134bp A/J, AKR/J
d 146bp B6.Cg-Lepob/+, C57BL/6J
e 152bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D16Mit9 a 142bp C57BL/6W, C57BL/10W
b 134bp A.CA/W, AKR/W
c 126bp 129/SvW, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory