About   Help   FAQ
D15Mit33 Primer Detail
Primers
  • Name
    D15Mit33
  • Primer 1 Sequence
    CAGGTTGTTAAAGGTGAGACTGG
  • Primer 2 Sequence
    CTGCATGTATGTACATGGTTGC
  • ID
    MGI:701070
  • Product Size
    148
  • Other IDs
    D15Mit33 (BROAD)
  • Note
    MIT assay: B367
    Additional information: MIT STS Marker Data Files
Genes
D15Mit33 DNA segment, Chr 15, Massachusetts Institute of Technology 33
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit33 a 144bp DBA/2J
b 152bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac
c 154bp AKR/J
d 156bp NON/ShiLt
e 160bp CAST/EiJ
f 166bp SPRET/EiJ
g 170bp LP/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit33 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
10/07/2025
MGI 6.24 		The Jackson Laboratory