About   Help   FAQ
D15Mit35 Primer Detail
Primers
  • Name
    D15Mit35
  • Primer 1 Sequence
    ATGCATTTTTAAAATTTAGT
  • Primer 2 Sequence
    CCCATAACTCTTGTGATAGTCAAA
  • ID
    MGI:701065
  • Product Size
    140
  • Other IDs
    D15Mit35 (BROAD)
  • Note
    MIT assay: A1092
    Additional information: MIT STS Marker Data Files
Genes
D15Mit35 DNA segment, Chr 15, Massachusetts Institute of Technology 35
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit35 a 146bp 129X1/Sv
f 142, 146bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit35 b larger than f C57BL/6J
c 146bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit35 a 130bp CAST/EiJ
b 136bp DBA/2J, NOD/MrkTac
c 142bp B6.Cg-Lepob/+, C57BL/6J
d 146bp A/J, BALB/cJ, C3H/HeJ, LP/J
e 148bp AKR/J
f 150bp NON/ShiLt
g 172bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory