D15Mit35 Primer Detail MGI Mouse MGI:701065

D15Mit35 Primer Detail

Name

D15Mit35
Primer 1 Sequence

ATGCATTTTTAAAATTTAGT
Primer 2 Sequence

CCCATAACTCTTGTGATAGTCAAA
ID

MGI:701065
Product Size

140
Other IDs

D15Mit35 (BROAD)
Note

MIT assay: A1092
Additional information: MIT STS Marker Data Files

D15Mit35

DNA segment, Chr 15, Massachusetts Institute of Technology 35

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit35	a	146bp	129X1/Sv
Not Specified	D15Mit35	f	142, 146bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D15Mit35	b	larger than f	C57BL/6J
	c	146bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit35	a	130bp	CAST/EiJ
	b	136bp	DBA/2J, NOD/MrkTac
	c	142bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	146bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	e	148bp	AKR/J
	f	150bp	NON/ShiLt
	g	172bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24